Methylorubrum zatmanii: B2G69_24695 Help Entry B2G69_24695       CDS       T04981                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mza  Methylorubrum zatmanii Pathway mza01100   Metabolic pathways mza01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mza00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     B2G69_24695    00074 Mycolic acid biosynthesis     B2G69_24695   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     B2G69_24695 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ARO57043 LinkDB All DBs Position complement(5342563..5342814) Genome browser AA seq 83 aa AA seqDB search MADVREAIFAFIAARNPGLPSGAVTGETSLVTSDALDSIGILDLMMHLGDRFGVEVDEDS FDLANFASVDTLAHFIDDRRSDV NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atggccgacgtgcgggaggcgatcttcgccttcatcgcggcccgcaacccgggccttccc tccggcgccgtcaccggggagacgtccctcgtgaccagcgacgcgctcgattcgatcggc atcctcgacctgatgatgcatctcggtgaccgcttcggcgtcgaggtcgacgaggacagc ttcgacctcgcgaacttcgccagcgtcgacacgctggcccatttcatcgacgaccggcgt tccgacgtctga

DBGET integrated database retrieval system