Nitrospirillum viridazoti: Y958_11470 Help Entry Y958_11470        CDS       T04935                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism nao  Nitrospirillum viridazoti Pathway nao01100   Metabolic pathways nao01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:nao00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Y958_11470    00074 Mycolic acid biosynthesis     Y958_11470   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Y958_11470 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  ASG21376 UniProt:  A0A248JS66 LinkDB All DBs Position 1:complement(2490742..2491008) Genome browser AA seq 88 aa AA seqDB search MTDTTIDRIRRGLATHFGIDAREVRPTTVIADDLHADSLDEIEITMLLEDEFNLPIPDGA ITGTNFTTVQDLADYIARCLPATQGTAA NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atgaccgacaccaccatcgaccgtatccggcgcggcctggcgacccacttcggcatcgac gccagggaggtgaggcccaccaccgtcatcgctgatgaccttcatgccgacagcctcgat gagatcgagatcaccatgctgctggaggacgaattcaaccttcccatcccggatggcgcc atcaccgggaccaacttcaccaccgtgcaggacctggccgactacatcgctcgctgcctg cccgccacgcaaggaaccgccgcatga

DBGET integrated database retrieval system