Nocardia brasiliensis: O3I_029040 Help Entry O3I_029040        CDS       T02270                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism nbr  Nocardia brasiliensis Pathway nbr00998   Biosynthesis of various antibiotics nbr01100   Metabolic pathways nbr01110   Biosynthesis of secondary metabolites Module nbr_M00885   Meromycolic acid biosynthesis, initiation and elongation FAS II (KasA) Brite KEGG Orthology (KO) [BR:nbr00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     O3I_029040    00074 Mycolic acid biosynthesis     O3I_029040   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     O3I_029040 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AFU03757 UniProt:  K0F239 LinkDB All DBs Position 6603584..6603865 Genome browser AA seq 93 aa AA seqDB search MNRVEIEERVIALISETMALPVEEMSDPATNLREDLGMDSMDFVDLLVDLERHLGHRVDR ELLVDIRTVGQVVDLVDDLAARRAQADAAEAIR NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atgaacagggtcgagatcgaggaacgcgtcatcgcgttgatcagcgagacgatggctttg ccggtcgaggaaatgtcggatccggcgaccaacctgcgcgaagacctcggcatggattcg atggatttcgtcgacctgctcgtcgatctggagcgccacctcggacaccgggtcgatcga gaactcctggtcgacatccgcacggtgggtcaggtggtcgacctcgtcgacgacctggcc gcgcggcgggcgcaggcggatgcggccgaggccattcgttga

DBGET integrated database retrieval system