Nonomuraea fuscirosea: OIE67_09790 Help Entry OIE67_09790       CDS       T09742                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism nfs  Nonomuraea fuscirosea Pathway nfs01100   Metabolic pathways nfs01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:nfs00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     OIE67_09790    00074 Mycolic acid biosynthesis     OIE67_09790   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     OIE67_09790 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  WSA54878 LinkDB All DBs Position complement(2191400..2191660) Genome browser AA seq 86 aa AA seqDB search MNREQTVEHIRVALSVVLDREIPELDADARLVEDLGLDSTNVVELMMALEDSIGLEVDLD ELEPEVFSTVATLADFVGAEALGAVS NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atgaaccgcgagcagaccgtcgagcacatccgcgtcgcactctccgtcgtactcgaccgg gagatccccgaactcgacgcggacgcccgcctcgtggaggacctcggtctggattccacc aacgtcgtcgagctgatgatggccctggaggacagcatcggcctggaagtcgacctggac gaactggaacccgaggtcttcagcaccgtcgccaccctggccgacttcgtgggagccgag gctctgggtgcggtgtcctga

DBGET integrated database retrieval system