Nocardioides sp. L-11A: QJ852_24540 Help Entry QJ852_24540       CDS       T10892                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism nocd  Nocardioides sp. L-11A Brite KEGG Orthology (KO) [BR:nocd00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:nocd03032]     QJ852_24540    03036 Chromosome and associated proteins [BR:nocd03036]     QJ852_24540    03400 DNA repair and recombination proteins [BR:nocd03400]     QJ852_24540 DNA replication proteins [BR:nocd03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     QJ852_24540 Chromosome and associated proteins [BR:nocd03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     QJ852_24540 DNA repair and recombination proteins [BR:nocd03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       QJ852_24540 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-CCDC81_bac_2 HU-HIG Motif Other DBs NCBI-ProteinID:  WGX96301 LinkDB All DBs Position 5125281..5125574 Genome browser AA seq 97 aa AA seqDB search MNRTDLTAAVAGATGLTPPRAAAAVAATLDAIVRGVDEHGSVTLAGFGTFERRSRAARTG RHPRTGEPMEIPASVTPAFRAAAAFRRRVADGSSAEN NT seq 294 nt NT seq  +upstreamnt  +downstreamnt atgaaccgcaccgacctgaccgccgccgtcgccggggcgaccggcctcacgcccccacgg gcggccgccgccgtcgcggcgaccctcgacgcgatcgtgcgcggggtcgacgagcacggg agcgtgacgctcgccggcttcgggaccttcgagcgacgcagccgcgcggcgcgcaccggg cgccacccgcgcaccggcgagccgatggagatccccgcgagcgtcacgccggccttcagg gccgccgcggcgttccggcggcgggtcgccgacgggagttccgccgaaaactag

DBGET integrated database retrieval system