Nocardioides sp. QY071: QI633_12370 Help Entry QI633_12370       CDS       T10893                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism nocq  Nocardioides sp. QY071 Pathway nocq01100   Metabolic pathways nocq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:nocq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QI633_12370    00074 Mycolic acid biosynthesis     QI633_12370   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QI633_12370 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF6017 Motif Other DBs NCBI-ProteinID:  WGY04536 LinkDB All DBs Position complement(2578960..2579208) Genome browser AA seq 82 aa AA seqDB search MRRVDPAEARAAVAGALLAIVPDADVESLGDDTPFRGELDLDSLDFLTFVETVCARTGVR IDEADYPRLTTVASCVAFLSEP NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgcgacgggtcgaccccgccgaagcccgcgctgctgtcgccggtgcgctgctcgccatc gttcccgacgccgacgtggagtcgctcggcgacgacactccgttccgcggcgagctcgac ctcgacagtctcgacttcctcacgttcgtcgagaccgtctgcgcgaggacgggagtacgc atcgacgaggcggactatcctcgcctgacgacggtggcgagctgcgtcgccttcctgtcc gagccgtga

DBGET integrated database retrieval system