Nocardia yunnanensis: D7D52_08030 Help Entry D7D52_08030       CDS       T09774                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism nyu  Nocardia yunnanensis Pathway nyu00998   Biosynthesis of various antibiotics nyu01100   Metabolic pathways nyu01110   Biosynthesis of secondary metabolites Module nyu_M00885   Meromycolic acid biosynthesis, initiation and elongation FAS II (KasA) Brite KEGG Orthology (KO) [BR:nyu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     D7D52_08030    00074 Mycolic acid biosynthesis     D7D52_08030   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     D7D52_08030 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AYF73821 UniProt:  A0A386Z827 LinkDB All DBs Position complement(1752957..1753208) Genome browser AA seq 83 aa AA seqDB search MSTDDTLRTVTEIAVAETGLPAAELTPDADLRAMAGVDSVRVLRMIARIERTYDIELEDE DVFGTATLAQVAVVVDRALRDAA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgagcaccgacgacaccctgcgcaccgtcaccgagatcgccgtcgccgagaccggactg cccgccgcggagctgacccccgacgccgatctgcgcgccatggcgggcgtggattcggtg cgggtgctgcgcatgatcgcgcgcatcgaacgcacctacgacatcgaactcgaggacgaa gacgtcttcggcaccgcgaccctggcccaggtggccgtggtcgtcgaccgggcgctgcgg gacgcggcatga

DBGET integrated database retrieval system