Ornithorhynchus anatinus (platypus): 100079807 Help Entry 100079807         CDS       T01045                                  Name (RefSeq) metallothionein-like   KO K14739   metallothionein 1/2 Organism oaa  Ornithorhynchus anatinus (platypus) Pathway oaa04978   Mineral absorption Brite KEGG Orthology (KO) [BR:oaa00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     100079807  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:oaa03019]     100079807    03029 Mitochondrial biogenesis [BR:oaa03029]     100079807 Messenger RNA biogenesis [BR:oaa03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      100079807 Mitochondrial biogenesis [BR:oaa03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     100079807 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  100079807 NCBI-ProteinID:  XP_001510732 LinkDB All DBs Position 11:33537136..33539603 Genome browser AA seq 90 aa AA seqDB search MRTGHSILTLSALSIILLHTTASCPAPMDPQNCGCAPDGSCACAASCKCKNCKCTSCKRS CCSCCPVGCAGCAQGCICKEPQTDKCSCCQ NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaggaccggccacagcatcctcaccttgtctgctctttccatcatccttctgcacaca acagcttcctgcccagcacccatggaccctcagaactgcggctgtgcccctgatggctct tgtgcctgtgccgcctcctgcaagtgtaaaaattgcaagtgtacttcgtgcaagagaagc tgctgttcctgctgtccggttgggtgtgccgggtgtgcccagggatgcatctgcaaagaa cctcagactgacaagtgcagctgctgccagtga

DBGET integrated database retrieval system