Entry |
|
Symbol |
MIR186
|
Name |
|
KO |
|
Organism |
oaa Ornithorhynchus anatinus (platypus)
|
Brite |
KEGG Orthology (KO) [BR:oaa00001]
09180 Brite Hierarchies
09183 Protein families: signaling and cellular processes
04147 Exosome [BR:oaa04147]
100314481 (MIR186)
09184 RNA family
03100 Non-coding RNAs [BR:oaa03100]
100314481 (MIR186)
Exosome [BR:oaa04147]
Exosomal RNA
Exosomal RNA of renal carcinoma cells
100314481 (MIR186)
Non-coding RNAs [BR:oaa03100]
Other eukaryotic RNA
Micro RNA
100314481 (MIR186)
|
SSDB |
|
Other DBs |
|
LinkDB |
|
Position |
4:116682490..116682573
|
NT seq |
22 nt +upstreamnt +downstreamnt
caaagaattctccttttgggct |