Ornithorhynchus anatinus (platypus): 100314519 Help Entry 100314519         miRNA     T01045                                  Symbol MIR184 Name (RefSeq) oan-miR-184   KO K17177   microRNA 184 Organism oaa  Ornithorhynchus anatinus (platypus) Brite KEGG Orthology (KO) [BR:oaa00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:oaa04147]     100314519 (MIR184)   09184 RNA family    03100 Non-coding RNAs [BR:oaa03100]     100314519 (MIR184) Exosome [BR:oaa04147]  Exosomal RNA   Exosomal RNA of renal carcinoma cells    100314519 (MIR184)   Exosomal RNA of other cancer cells    100314519 (MIR184) Non-coding RNAs [BR:oaa03100]  Other eukaryotic RNA   Micro RNA    100314519 (MIR184) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314519 Ensembl:  ENSOANG00000037389 miRBase:  MI0006814 LinkDB All DBs Position X1:56007178..56007305 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tggacggagaattgataagggt

DBGET integrated database retrieval system