Ornithorhynchus anatinus (platypus): 100314651 Help Entry 100314651         miRNA     T01045                                  Symbol MIR29B-1 Name (RefSeq) oan-miR-29b-5p   KO K16996   microRNA 29b Organism oaa  Ornithorhynchus anatinus (platypus) Pathway oaa05206   MicroRNAs in cancer oaa05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:oaa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100314651 (MIR29B-1)    05207 Chemical carcinogenesis - receptor activation     100314651 (MIR29B-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:oaa04147]     100314651 (MIR29B-1)   09184 RNA family    03100 Non-coding RNAs [BR:oaa03100]     100314651 (MIR29B-1) Exosome [BR:oaa04147]  Exosomal RNA   Exosomal RNA of breast milk    100314651 (MIR29B-1)   Exosomal RNA of saliva    100314651 (MIR29B-1) Non-coding RNAs [BR:oaa03100]  Small non-coding RNA   Micro RNA    100314651 (MIR29B-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314651 Ensembl:  ENSOANG00000017029 miRBase:  MI0006669 LinkDB All DBs Position 10:complement(47607545..47607665) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt ctggtttcatatggtggtttag

DBGET integrated database retrieval system