Ornithorhynchus anatinus (platypus): 100314734 Help Entry 100314734         miRNA     T01045                                  Symbol MIR16A Name (RefSeq) oan-miR-16a-5p   KO K16988   microRNA 16 Organism oaa  Ornithorhynchus anatinus (platypus) Pathway oaa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:oaa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100314734 (MIR16A)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:oaa04147]     100314734 (MIR16A)   09184 RNA family    03100 Non-coding RNAs [BR:oaa03100]     100314734 (MIR16A) Exosome [BR:oaa04147]  Exosomal RNA   Exosomal RNA of breast milk    100314734 (MIR16A)   Exosomal RNA of hepatic cancer cells    100314734 (MIR16A)   Exosomal RNA of lung cancer cells    100314734 (MIR16A)   Exosomal RNA of other cancer cells    100314734 (MIR16A) Non-coding RNAs [BR:oaa03100]  Other eukaryotic RNA   Micro RNA    100314734 (MIR16A) SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  100314734 Ensembl:  ENSOANG00000016979 miRBase:  MI0006887 LinkDB All DBs Position 20:8171709..8171730 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tagcagcacgtaaatattggcg

DBGET integrated database retrieval system