Ornithorhynchus anatinus (platypus): 100314759 Help Entry 100314759         miRNA     T01045                                  Symbol MIR133B Name (RefSeq) oan-miR-133b-5p   KO K16971   microRNA 133b Organism oaa  Ornithorhynchus anatinus (platypus) Pathway oaa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:oaa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100314759 (MIR133B)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:oaa04147]     100314759 (MIR133B)   09184 RNA family    03100 Non-coding RNAs [BR:oaa03100]     100314759 (MIR133B) Exosome [BR:oaa04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    100314759 (MIR133B)   Exosomal RNA of hepatic cancer cells    100314759 (MIR133B) Non-coding RNAs [BR:oaa03100]  Small non-coding RNA   Micro RNA    100314759 (MIR133B) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314759 Ensembl:  ENSOANG00000016550 miRBase:  MI0006780 LinkDB All DBs Position X1:16303129..16303226 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt gctggtcaaacggaaccaagtc

DBGET integrated database retrieval system