Ovis aries (sheep): 102466857 Help Entry 102466857         miRNA     T03117                                  Symbol MIR16B Name (RefSeq) oar-miR-16b   KO K16988   microRNA 16 Organism oas  Ovis aries (sheep) Pathway oas05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:oas00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     102466857 (MIR16B)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:oas04147]     102466857 (MIR16B)   09184 RNA family    03100 Non-coding RNAs [BR:oas03100]     102466857 (MIR16B) Exosome [BR:oas04147]  Exosomal RNA   Exosomal RNA of breast milk    102466857 (MIR16B)   Exosomal RNA of hepatic cancer cells    102466857 (MIR16B)   Exosomal RNA of lung cancer cells    102466857 (MIR16B)   Exosomal RNA of other cancer cells    102466857 (MIR16B) Non-coding RNAs [BR:oas03100]  Other eukaryotic RNA   Micro RNA    102466857 (MIR16B) SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  102466857 miRBase:  MI0025257 LinkDB All DBs Position 1:complement(227751367..227751386) Genome browser NT seq 20 nt NT seq  +upstreamnt  +downstreamnt tagcagcacgtaaatattgg

DBGET integrated database retrieval system