Oceanobacillus zhaokaii: CUC15_09010 Help Entry CUC15_09010       CDS       T05570                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ocn  Oceanobacillus zhaokaii Pathway ocn01100   Metabolic pathways ocn01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ocn00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CUC15_09010    00074 Mycolic acid biosynthesis     CUC15_09010   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CUC15_09010 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AXI09051 UniProt:  A0A345PGC1 LinkDB All DBs Position 1786348..1786581 Genome browser AA seq 77 aa AA seqDB search MAEVFDRIKEIIIDRLDVEESKVTMEASFKDDLEADSLDVVELVMELEDEFDLEIADEEA ENINTVGDAVNYINSKQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagaggtatttgatcgcatcaaagaaattattatcgatcgtcttgatgttgaagag tctaaagtaacaatggaagcatctttcaaagatgaccttgaggctgattcactagacgtt gttgagcttgtaatggagcttgaagacgaattcgatttagaaatagctgatgaagaagct gaaaatattaatacagtaggtgacgctgttaactacataaatagcaaacagtaa

DBGET integrated database retrieval system