Oryctolagus cuniculus (rabbit): 100343557 Help Entry 100343557         CDS       T03373                                  Name (RefSeq) metallothionein-2D   KO K14739   metallothionein 1/2 Organism ocu  Oryctolagus cuniculus (rabbit) Pathway ocu04978   Mineral absorption Brite KEGG Orthology (KO) [BR:ocu00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     100343557  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:ocu03019]     100343557    03029 Mitochondrial biogenesis [BR:ocu03029]     100343557 Messenger RNA biogenesis [BR:ocu03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      100343557 Mitochondrial biogenesis [BR:ocu03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     100343557 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  100343557 NCBI-ProteinID:  XP_008255539 Ensembl:  ENSOCUG00000029235 UniProt:  P80291 LinkDB All DBs Position 5:12951945..12953625 Genome browser AA seq 61 aa AA seqDB search MDPNCSCATRDSCACASSCKCKECKCTSCKKSCCSCCPAGCTKCAQGCICKGASDKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgcgccacccgtgactcctgcgcctgtgccagctcctgcaaa tgcaaagaatgcaaatgcacctcctgcaagaagagctgctgctcctgctgccctgcgggc tgcaccaagtgtgcccagggctgcatctgcaaaggggcatcagacaagtgcagctgctgc gcctga

DBGET integrated database retrieval system