Oryctolagus cuniculus (rabbit): 114482809 Help Entry 114482809         miRNA     T03373                                  Symbol MIR30A Name (RefSeq) ocu-miR-30a-5p   KO K17110   microRNA 30 Organism ocu  Oryctolagus cuniculus (rabbit) Pathway ocu05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ocu00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     114482809 (MIR30A)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ocu04147]     114482809 (MIR30A)   09184 RNA family    03100 Non-coding RNAs [BR:ocu03100]     114482809 (MIR30A) Exosome [BR:ocu04147]  Exosomal RNA   Exosomal RNA of breast milk    114482809 (MIR30A)   Exosomal RNA of hepatic cancer cells    114482809 (MIR30A)   Exosomal RNA of lung cancer cells    114482809 (MIR30A) Non-coding RNAs [BR:ocu03100]  Other eukaryotic RNA   Micro RNA    114482809 (MIR30A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  114482809 LinkDB All DBs Position 12:97659512..97659573 Genome browser NT seq 24 nt NT seq  +upstreamnt  +downstreamnt tgtaaacatcctcgactggaagct

DBGET integrated database retrieval system