Oryctolagus cuniculus (rabbit): 114482903 Help Entry 114482903         miRNA     T03373                                  Symbol MIR204 Name (RefSeq) ocu-miR-204-5p   KO K17166   microRNA 204 Organism ocu  Oryctolagus cuniculus (rabbit) Brite KEGG Orthology (KO) [BR:ocu00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ocu04147]     114482903 (MIR204)   09184 RNA family    03100 Non-coding RNAs [BR:ocu03100]     114482903 (MIR204) Exosome [BR:ocu04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    114482903 (MIR204) Non-coding RNAs [BR:ocu03100]  Other eukaryotic RNA   Micro RNA    114482903 (MIR204) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  114482903 LinkDB All DBs Position 1:complement(71141243..71141302) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt ttccctttgtcatcctatgcct

DBGET integrated database retrieval system