Tepiditoga spiralis: OSSY52_09130 Help Entry OSSY52_09130      CDS       T06810                                  Symbol acpP_2 Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ocy  Tepiditoga spiralis Pathway ocy01100   Metabolic pathways ocy01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ocy00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     OSSY52_09130 (acpP_2)    00074 Mycolic acid biosynthesis     OSSY52_09130 (acpP_2)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     OSSY52_09130 (acpP_2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Ribosomal_L50 DUF1327 Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  BBE30772 UniProt:  A0A7G1G9N3 LinkDB All DBs Position 1025367..1025621 Genome browser AA seq 84 aa AA seqDB search MTREELFDKMKEVIVETLGVEEEDVKLDSSFVDDLDADSLELVDLTMALESELGVTIEDD EIESLKSVEDALKIVANKLNIDED NT seq 255 nt NT seq  +upstreamnt  +downstreamnt gtgacaagagaagaactttttgataagatgaaagaggttattgtagaaactctcggtgtt gaagaagaagatgtaaaactcgactcttcctttgtagacgatttggacgcagattcactt gaattagtagatttaactatggctcttgaatctgaacttggagtaactattgaagacgat gagatagaaagtctaaagtctgtagaagatgcactgaaaattgtagcaaataaattaaat attgacgaagattaa

DBGET integrated database retrieval system