Osmerus eperlanus (European smelt): 134020979 Help Entry 134020979         CDS       T10927                                  Symbol mt2 Name (RefSeq) metallothionein-2   KO K14739   metallothionein 1/2 Organism oep  Osmerus eperlanus (European smelt) Brite Messenger RNA biogenesis [BR:oep03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      134020979 (mt2) Mitochondrial biogenesis [BR:oep03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     134020979 (mt2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  134020979 NCBI-ProteinID:  XP_062317355 LinkDB All DBs Position 5:complement(5494777..5495467) Genome browser AA seq 61 aa AA seqDB search MDPCECSKTGSCNCGGNCSCTNCACTSCKKTSCCACCPAGCSKCASGCVCKGKTCDKTCC Q NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatccatgtgaatgctccaagactggatcatgcaactgcggtggtaactgtagctgt actaactgcgcctgcacatcttgcaagaagaccagctgctgcgcctgctgtccagccggg tgcagcaagtgcgcctccgggtgcgtgtgcaaagggaagacctgcgacaagacctgctgt cagtga

DBGET integrated database retrieval system