Oncorhynchus gorbuscha (pink salmon): 124000454 Help Entry 124000454         CDS       T07892                                  Name (RefSeq) metallothionein A   KO K14739   metallothionein 1/2 Organism ogo  Oncorhynchus gorbuscha (pink salmon) Brite KEGG Orthology (KO) [BR:ogo00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:ogo03019]     124000454    03029 Mitochondrial biogenesis [BR:ogo03029]     124000454 Messenger RNA biogenesis [BR:ogo03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      124000454 Mitochondrial biogenesis [BR:ogo03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     124000454 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  124000454 NCBI-ProteinID:  XP_046162770 LinkDB All DBs Position LG02:complement(29032763..29033487) Genome browser AA seq 61 aa AA seqDB search MDPCECSKTGTCNCGGSCKCSNCACTSCKKASCCDCCPSGCSKCASGCVCKGKTCDTSCC Q NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatccttgtgaatgctccaaaactggaacttgcaactgcggtggatcctgcaagtgc tccaactgcgcatgcaccagttgtaagaaagcaagttgctgcgactgctgtccctccggc tgcagcaagtgtgcctcaggctgcgtgtgcaagggcaagacttgtgataccagctgttgt cagtga

DBGET integrated database retrieval system