Oryzias latipes (Japanese medaka): 102464700 Help Entry 102464700         miRNA     T02443                                  Symbol mir29b-1 Name (RefSeq) ola-miR-29b   KO K16996   microRNA 29b Organism ola  Oryzias latipes (Japanese medaka) Brite KEGG Orthology (KO) [BR:ola00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ola04147]     102464700 (mir29b-1)   09184 RNA family    03100 Non-coding RNAs [BR:ola03100]     102464700 (mir29b-1) Exosome [BR:ola04147]  Exosomal RNA   Exosomal RNA of breast milk    102464700 (mir29b-1)   Exosomal RNA of saliva    102464700 (mir29b-1) Non-coding RNAs [BR:ola03100]  Small non-coding RNA   Micro RNA    102464700 (mir29b-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  102464700 miRBase:  MI0019446 LinkDB All DBs Position 7:23066877..23066978 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tagcaccatttgaaatcagtgt

DBGET integrated database retrieval system