Oryzias latipes (Japanese medaka): 102466093 Help Entry 102466093         miRNA     T02443                                  Symbol mir103-2 Name (RefSeq) ola-miR-103   KO K16989   microRNA 103 Organism ola  Oryzias latipes (Japanese medaka) Brite KEGG Orthology (KO) [BR:ola00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ola04147]     102466093 (mir103-2)   09184 RNA family    03100 Non-coding RNAs [BR:ola03100]     102466093 (mir103-2) Exosome [BR:ola04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    102466093 (mir103-2)   Exosomal RNA of ovarian cancer cells    102466093 (mir103-2) Non-coding RNAs [BR:ola03100]  Other eukaryotic RNA   Micro RNA    102466093 (mir103-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  102466093 miRBase:  MI0019544 LinkDB All DBs Position 22:complement(25642887..25642907) Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt agcagcattgtacagggctat

DBGET integrated database retrieval system