Oncorhynchus mykiss (rainbow trout): 100136731 Help Entry 100136731         CDS       T07259                                  Symbol mt2 Name (RefSeq) metallothionein A   KO K14739   metallothionein 1/2 Organism omy  Oncorhynchus mykiss (rainbow trout) Brite KEGG Orthology (KO) [BR:omy00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:omy03019]     100136731 (mt2)    03029 Mitochondrial biogenesis [BR:omy03029]     100136731 (mt2) Messenger RNA biogenesis [BR:omy03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      100136731 (mt2) Mitochondrial biogenesis [BR:omy03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     100136731 (mt2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  100136731 NCBI-ProteinID:  XP_021453084 Ensembl:  ENSOMYG00000013749 LinkDB All DBs Position 1:complement(27551335..27552061) Genome browser AA seq 61 aa AA seqDB search MDPCECSKTGSCNCGGSCKCSNCACTSCKKASCCDCCPSGCSKCASGCVCKGKTCDTSCC Q NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatccttgtgaatgctccaaaactggatcttgcaactgcggtggatcctgcaagtgc tccaactgcgcatgcaccagttgtaagaaagcaagttgctgcgactgctgtccctccggc tgcagcaagtgtgcctcaggctgcgtgtgcaagggcaagacttgtgataccagctgttgt cagtga

DBGET integrated database retrieval system