Oligella ureolytica: I6G29_09400 Help Entry I6G29_09400       CDS       T07321                                  Symbol grxC Name (GenBank) glutaredoxin 3   KO K03676   glutaredoxin 3 Organism oue  Oligella ureolytica Brite KEGG Orthology (KO) [BR:oue00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:oue03110]     I6G29_09400 (grxC) Chaperones and folding catalysts [BR:oue03110]  Protein folding catalysts   Protein disulfide isomerase    I6G29_09400 (grxC) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 SH3BGR GST_N_2 Glrx-like DSBA Thioredoxin_3 Thioredoxin_4 GST_N Thioredoxin_2 YfjL_C CLIC-like_N Thioredoxin_14 Motif Other DBs NCBI-ProteinID:  QPT39380 LinkDB All DBs Position complement(1893188..1893448) Genome browser AA seq 86 aa AA seqDB search MAQVTMYCKVTCPYCTRAAKILKAHNVDYESISIDTNREARAEMIERSNGRTTVPQIFIN GQHIGGCDDLQALEREGKLEALLAAE NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atggctcaagttactatgtactgtaaggtcacttgcccttactgcacccgtgctgccaaa attcttaaagcacataatgtcgactacgaaagcatcagcattgacaccaatcgcgaagca cgcgccgaaatgatcgagcgctccaacggtcgcactaccgtgccacaaatctttatcaat ggccagcacatcggtggctgtgacgacctacaagcgttagagcgtgaaggcaaattagaa gctctgttagctgcagaataa

DBGET integrated database retrieval system