Pseudomonas aeruginosa NCGM 1900: NCGM1900_4621 Help Entry NCGM1900_4621     CDS       T03789                                  Name (GenBank) putative acyl carrier protein   KO K02078   acyl carrier protein Organism paeb  Pseudomonas aeruginosa NCGM 1900 Pathway paeb01100   Metabolic pathways paeb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paeb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     NCGM1900_4621    00074 Mycolic acid biosynthesis     NCGM1900_4621   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     NCGM1900_4621 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  BAP23701 UniProt:  A0A071KT89 LinkDB All DBs Position complement(4907699..4907938) Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARLGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaagctggtagccgcccggctcggcgtggaggaa tgcgacatccggctggacagcgatttccgtaacgacttcggtgccgagtcgctcgaggtg gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system