Pseudomonas aeruginosa c7447m: M802_1926 Help Entry M802_1926         CDS       T03098                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paec  Pseudomonas aeruginosa c7447m Pathway paec01100   Metabolic pathways paec01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paec00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     M802_1926 (acpP)    00074 Mycolic acid biosynthesis     M802_1926 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     M802_1926 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AGV63361 LinkDB All DBs Position 2031034..2031273 Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARFGVEECDIRLDSDFRNDFGAESLEVVELVMALETEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtagccgcccggttcggcgtggaggaa tgcgacatccggctggacagcgacttccgtaacgacttcggtgccgagtcgctcgaggtg gtcgaactggtcatggccctggaaacggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system