Paenibacillus sp. FSL R7-0331: R70331_04925 Help Entry R70331_04925      CDS       T03357                                  Name (GenBank) translocase   KO K03116   sec-independent protein translocase protein TatA Organism paee  Paenibacillus sp. FSL R7-0331 Pathway paee03060   Protein export paee03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:paee00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     R70331_04925  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     R70331_04925  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:paee02044]     R70331_04925 Secretion system [BR:paee02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    R70331_04925 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E Motif Other DBs NCBI-ProteinID:  AIQ50935 UniProt:  A0A089KT37 LinkDB All DBs Position 1114472..1114714 Genome browser AA seq 80 aa AA seqDB search MLSGIGAPGIILLVILALLLFGPNKLPELGRAVGRTFREFKDGAREIISEPEPAKRSEAP ATPAPQSLAADLPQDRKLPE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgctgagtggtattggtgctcccggaattattctactggtgatcctggcgctgctgctg tttggtccgaataagctccctgagcttggccgggcggtcggacgtaccttccgtgaattc aaggacggcgcacgtgaaattatcagtgaaccggaaccggctaagcgcagtgaagctcct gctacgccggccccgcagtcattagctgcagatcttccgcaggaccggaagctgccggaa taa

DBGET integrated database retrieval system