Paenibacillus sp. FSL R5-0345: R50345_13620 Help Entry R50345_13620      CDS       T03333                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paef  Paenibacillus sp. FSL R5-0345 Pathway paef00998   Biosynthesis of various antibiotics paef01100   Metabolic pathways paef01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paef00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     R50345_13620    00074 Mycolic acid biosynthesis     R50345_13620   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     R50345_13620 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AIQ35560 LinkDB All DBs Position 3031527..3031760 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA ETITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattagagcgtgtaaaacgcattgtcatcgaccgcttaggtgccgatgaa gctgaggtaacattagaagcgtctttcaaagatgatttaggtgctgattctcttgatgta gtagaattggttatggaattggaagatgaattcgacatggaaatctctgatgaagatgca gagaccattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system