Pseudomonas aeruginosa PAO1-VE2: N296_1928 Help Entry N296_1928         CDS       T03170                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paei  Pseudomonas aeruginosa PAO1-VE2 Pathway paei01100   Metabolic pathways paei01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paei00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     N296_1928 (acpP)    00074 Mycolic acid biosynthesis     N296_1928 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     N296_1928 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AGY68091 LinkDB All DBs Position 2031461..2031700 Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARFGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtagccgcccggttcggcgtggaggaa tgcgacatccggctggacagcgacttccgtaacgacttcggtgccgagtcgctcgaggta gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system