Paenibacillus sp. FSL P4-0081: P40081_06160 Help Entry P40081_06160      CDS       T03332                                  Name (GenBank) translocase   KO K03116   sec-independent protein translocase protein TatA Organism paen  Paenibacillus sp. FSL P4-0081 Pathway paen03060   Protein export paen03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:paen00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     P40081_06160  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     P40081_06160  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:paen02044]     P40081_06160 Secretion system [BR:paen02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    P40081_06160 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E Motif Other DBs NCBI-ProteinID:  AIQ27819 LinkDB All DBs Position 1388876..1389118 Genome browser AA seq 80 aa AA seqDB search MLNGIGAPGIILLVILALLLFGPNKLPELGRAVGRTFREFKDGAREIINEPEPARKSEVP APPAPQTVAAELPQDRRLPE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgctaaatggtattggtgcacccggaattattctattggttatcttggcgctcctgctc tttggcccgaataagcttcctgagcttgggcgggcagtcggacgtaccttccgtgaattc aaggacggggcgcgggagatcattaatgaaccggaaccggcccggaagagtgaagtgcct gctcctccggctccgcagactgtagcagcagaacttccgcaggaccgccgtctgccggaa taa

DBGET integrated database retrieval system