Paenibacillus sp. FSL P4-0081: P40081_17150 Help Entry P40081_17150      CDS       T03332                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paen  Paenibacillus sp. FSL P4-0081 Pathway paen00998   Biosynthesis of various antibiotics paen01100   Metabolic pathways paen01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paen00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     P40081_17150    00074 Mycolic acid biosynthesis     P40081_17150   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     P40081_17150 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AIQ29688 LinkDB All DBs Position 3840826..3841059 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA ESITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcattgtcatcgaccgcttaggtgccgatgaa gctgaggtaacattagaagcgtctttcaaagatgatttaggtgctgattctcttgatgta gtagaattggttatggaattggaagatgaattcgatatggaaatctctgatgaagatgca gagagtattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system