Pseudomonas aeruginosa PAO581: M801_1927 Help Entry M801_1927         CDS       T03171                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paeo  Pseudomonas aeruginosa PAO581 Pathway paeo01100   Metabolic pathways paeo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paeo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     M801_1927 (acpP)    00074 Mycolic acid biosynthesis     M801_1927 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     M801_1927 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AGV59086 LinkDB All DBs Position 2031346..2031585 Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARFGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtagccgcccggttcggcgtggaggaa tgcgacatccggctggacagcgacttccgtaacgacttcggtgccgagtcgctcgaggta gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system