Pseudomonas aeruginosa PA1: PA1S_16600 Help Entry PA1S_16600        CDS       T02928                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paep  Pseudomonas aeruginosa PA1 Pathway paep01100   Metabolic pathways paep01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paep00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PA1S_16600    00074 Mycolic acid biosynthesis     PA1S_16600   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PA1S_16600 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AHA21397 LinkDB All DBs Position complement(3588779..3589018) Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARFGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtagccgcccggttcggcgtggaggaa tgcgacatccggctggacagcgacttccgtaacgacttcggtgccgagtcgctcgaggta gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system