Paenibacillus sp. FSL R5-0912: R50912_05460 Help Entry R50912_05460      CDS       T03334                                  Name (GenBank) translocase   KO K03116   sec-independent protein translocase protein TatA Organism paeq  Paenibacillus sp. FSL R5-0912 Pathway paeq03060   Protein export paeq03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:paeq00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     R50912_05460  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     R50912_05460  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:paeq02044]     R50912_05460 Secretion system [BR:paeq02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    R50912_05460 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E Motif Other DBs NCBI-ProteinID:  AIQ39546 UniProt:  A0A089JS14 LinkDB All DBs Position 1230804..1231046 Genome browser AA seq 80 aa AA seqDB search MLNGIGAPGIILLVILALLLFGPNKLPELGRAVGRTFREFKDGAREIINEPESARKSEVP APPAPQTVAAELPQDRRLPE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgctaaatggtattggtgcacccggaattattctgttggttatcttggcgctcctgctc tttggcccgaataagcttcctgagcttgggcgggcagtcggacgtaccttccgtgaattc aaggacggggcgcgggagatcattaatgaaccggaatcggcccggaagagtgaagtgcct gctcccccggctccgcagactgtagcagcagaacttccgcaggaccgccgtctgccggaa taa

DBGET integrated database retrieval system