Paenibacillus sp. FSL R5-0912: R50912_16010 Help Entry R50912_16010      CDS       T03334                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paeq  Paenibacillus sp. FSL R5-0912 Pathway paeq00998   Biosynthesis of various antibiotics paeq01100   Metabolic pathways paeq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paeq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     R50912_16010    00074 Mycolic acid biosynthesis     R50912_16010   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     R50912_16010 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  AIQ41366 LinkDB All DBs Position 3636482..3636715 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA ESITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcattgtcatcgaccgcttaggtgccgatgaa gctgaggtaacattagaagcgtctttcaaagatgatttaggtgctgattctcttgatgta gtagaattggttatggaattggaagatgaattcgatatggaaatctctgatgaagatgca gagagtattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system