Pseudomonas aeruginosa PA1R: PA1R_gp5496 Help Entry PA1R_gp5496       CDS       T02929                                  Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism paer  Pseudomonas aeruginosa PA1R Pathway paer01100   Metabolic pathways paer01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paer00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PA1R_gp5496    00074 Mycolic acid biosynthesis     PA1R_gp5496   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PA1R_gp5496 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF1493 Ribosomal_L12_N DUF7080 Motif Other DBs NCBI-ProteinID:  AHA27196 LinkDB All DBs Position 6096825..6097064 Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARFGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaaactggtagccgcccggttcggcgtggaggaa tgcgacatccggctggacagcgacttccgtaacgacttcggtgccgagtcgctcgaggta gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactatctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system