Pseudomonas aeruginosa PA38182: BN889_02021 Help Entry BN889_02021       CDS       T03031                                  Name (GenBank) putative acyl carrier protein   KO K02078   acyl carrier protein Organism paeu  Pseudomonas aeruginosa PA38182 Pathway paeu01100   Metabolic pathways paeu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paeu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BN889_02021    00074 Mycolic acid biosynthesis     BN889_02021   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BN889_02021 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Ribosomal_L12_N DUF1493 DUF7080 Motif Other DBs NCBI-ProteinID:  CDI90080 LinkDB All DBs Position 2095923..2096162 Genome browser AA seq 79 aa AA seqDB search MDDIETRVRKLVAARLGVEECDIRLDSDFRNDFGAESLEVVELVMALEAEFGVEIADDDA ERIETVRQAIDYLEEAVPT NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggacgacatcgagaccagagtgaggaagctggtagccgcccggctcggcgtggaggaa tgcgacatccggctggacagcgatttccgtaacgacttcggtgccgagtcgctcgaggtg gtcgaactggtcatggccctggaagcggagttcggcgtcgagatcgccgatgacgatgcg gaacggatcgagaccgtgcgccaggccatcgactacctcgaggaagccgtgccgacctga

DBGET integrated database retrieval system