Paenibacillus sp. IHB B 3084: ASL14_01580 Help Entry ASL14_01580       CDS       T05348                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism paih  Paenibacillus sp. IHB B 3084 Pathway paih00998   Biosynthesis of various antibiotics paih01100   Metabolic pathways paih01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:paih00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ASL14_01580    00074 Mycolic acid biosynthesis     ASL14_01580   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ASL14_01580 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  ALP35062 UniProt:  A0A0S2S043 LinkDB All DBs Position complement(345110..345343) Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgacgtattggagcgcgtaaagcgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatctttcaaagatgatttaggcgctgattctctcgatgta gttgaattggttatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaaccgtaggtgaagttgtaaagtacatacaatctcatacctaa

DBGET integrated database retrieval system