Pseudonocardia alni: PaSha_27270 Help Entry PaSha_27270       CDS       T11230                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism palq  Pseudonocardia alni Pathway palq01056   Biosynthesis of type II polyketide backbone palq01100   Metabolic pathways palq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:palq00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     PaSha_27270    00253 Tetracycline biosynthesis     PaSha_27270  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:palq01004]     PaSha_27270    01008 Polyketide biosynthesis proteins [BR:palq01008]     PaSha_27270 Lipid biosynthesis proteins [BR:palq01004]  Polyketide synthase   Component type    PaSha_27270 Polyketide biosynthesis proteins [BR:palq01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      PaSha_27270     Nonaketide PKS      PaSha_27270     Decaketide PKS      PaSha_27270 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  WFG47409 LinkDB All DBs Position pPaSha1:121684..121896 Genome browser AA seq 70 aa AA seqDB search MTRAAGAPESVPGDFLDAPFEDLGYDSLALLETASLIQARWSIALPDAVVVEARTPRELI ALVNDAIASR NT seq 213 nt NT seq  +upstreamnt  +downstreamnt atgacccgcgcggcgggcgccccggagtccgtcccgggggacttcctcgacgcaccgttc gaggacctcggctacgactcgctggcgctgctcgagacggccagcctgatccaggcccga tggagcatcgcgctcccggacgcggtcgtggtcgaggcccgcacaccgcgcgagctgatc gcgctcgtcaacgacgcgatcgccagccgttga

DBGET integrated database retrieval system