Pandoraea sp. XY-2: DRB87_12765 Help Entry DRB87_12765       CDS       T06086                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism pand  Pandoraea sp. XY-2 Brite KEGG Orthology (KO) [BR:pand00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:pand03032]     DRB87_12765    03036 Chromosome and associated proteins [BR:pand03036]     DRB87_12765    03400 DNA repair and recombination proteins [BR:pand03400]     DRB87_12765 DNA replication proteins [BR:pand03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     DRB87_12765 Chromosome and associated proteins [BR:pand03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     DRB87_12765 DNA repair and recombination proteins [BR:pand03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       DRB87_12765 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 UBA_HYPK HU-CCDC81_euk_2 Motif Other DBs NCBI-ProteinID:  QBC32058 LinkDB All DBs Position complement(2807029..2807301) Genome browser AA seq 90 aa AA seqDB search MNKTELIDHIAGEADISKAAAGRALEALVGAVKKSLKKGDSVTLVGFGTFLVAKRAARTG RNPRTGAAIKIKAAKVPKFRPGKVLKDTLN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt gtgaacaagacggaactgatcgatcatatcgcgggtgaagcagacatctcgaaagcggct gccggtcgggcacttgaagcattggtgggtgcggtaaagaaatcgctgaagaagggagac agcgtgacgttggtcggcttcggtaccttcctcgtggccaagcgtgcggcgcgtaccgga cgcaacccgcgcacgggcgccgcgatcaagatcaaggcagcgaaggttccgaaatttcgc cctggcaaagtattgaaagatacgttaaactga

DBGET integrated database retrieval system