Paraburkholderia sp. SOS3: BTO02_27090 Help Entry BTO02_27090       CDS       T04966                                  Name (GenBank) DNA-binding protein   KO K03746   DNA-binding protein H-NS Organism para  Paraburkholderia sp. SOS3 Brite KEGG Orthology (KO) [BR:para00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:para03036]     BTO02_27090    03400 DNA repair and recombination proteins [BR:para03400]     BTO02_27090 Chromosome and associated proteins [BR:para03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     BTO02_27090 DNA repair and recombination proteins [BR:para03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       BTO02_27090 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS Histone_HNS_N Motif Other DBs NCBI-ProteinID:  APR39030 LinkDB All DBs Position 2:1578564..1578818 Genome browser AA seq 84 aa AA seqDB search MKEREEHRLFDADGEARDRLIVWIRRRMEEYGISIEALAAALTEDAATPKYRDAYGNTWD GKGERPDWLTRAINAGQDIEHFRC NT seq 255 nt NT seq  +upstreamnt  +downstreamnt atgaaagaacgagaggaacatcgattgttcgacgccgacggtgaggcgcgcgaccggctg atcgtgtggatcagacgccgcatggaagagtacggtatttcaatcgaagcgttggccgca gcgctaaccgaagatgcggcgactccgaaataccgcgacgcttacggcaacacatgggac ggcaagggcgaacgcccggactggctcacgcgcgcgatcaacgcggggcaggatatcgag cattttcgttgttag

DBGET integrated database retrieval system