Peribacillus asahii: BAOM_1621 Help Entry BAOM_1621         CDS       T06700                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pasa  Peribacillus asahii Pathway pasa01100   Metabolic pathways pasa01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pasa00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BAOM_1621 (acpP)    00074 Mycolic acid biosynthesis     BAOM_1621 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BAOM_1621 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Guanylate_cyc DUF1493 Motif Other DBs NCBI-ProteinID:  AZV42231 UniProt:  A0A3T0KPR0 LinkDB All DBs Position 1545080..1545313 Genome browser AA seq 77 aa AA seqDB search MADVLERVTKIVVDRLNVEESEVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDDDA EKIATVGDAVNYIQSVL NT seq 234 nt NT seq  +upstreamnt  +downstreamnt gtggcagacgtattagaaagagtaacaaaaatcgtagtagatcgtttgaatgttgaagaa tcagaagtaaaacttgaggcttcattcaaagaagatcttggtgcagattctctagatgta gtagaacttgtaatggaacttgaagacgagtttgatatggagatttctgacgatgatgca gaaaaaatcgctacagtaggagatgctgtaaattacatacagagtgtattgtaa

DBGET integrated database retrieval system