Paenibacillus sp. S02: KAI36_01992 Help Entry KAI36_01992       CDS       T11472                                  Symbol acpA Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism pasz  Paenibacillus sp. S02 Pathway pasz00998   Biosynthesis of various antibiotics pasz01100   Metabolic pathways pasz01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pasz00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     KAI36_01992 (acpA)    00074 Mycolic acid biosynthesis     KAI36_01992 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     KAI36_01992 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  QYK66845 LinkDB All DBs Position 2219742..2219975 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgcgtaaaacgcattgtcgttgaccgtttgggagccgacgaa gccgaagttacacttgaagcatcttttaaagatgatttaggcgctgattctctcgatgta gttgaattggtaatggaattggaagatgagtttgatatggaaatctctgatgaagatgca gagaaaattacaactgtaggtgaagttgtgaagtacatacaatctcatacctaa

DBGET integrated database retrieval system