KEGG   Photorhabdus asymbiotica: PAU_00150
Entry
PAU_00150         CDS       T00941                                 
Symbol
yhgG
Name
(GenBank) similar to putative DNA-binding transcriptional regulator protein yhgg of escherichia coli
  KO
K07490  ferrous iron transport protein C
Organism
pay  Photorhabdus asymbiotica
Brite
KEGG Orthology (KO) [BR:pay00001]
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   02000 Transporters [BR:pay02000]
    PAU_00150 (yhgG)
Transporters [BR:pay02000]
 Other transporters
  Others
   PAU_00150 (yhgG)
SSDB
Motif
Pfam: FeoC Dimerisation Peptidase_S66C DUF2250
Other DBs
NCBI-ProteinID: CAQ82243
UniProt: A0ABX9SGX7 C7BGR4
LinkDB
Position
complement(160962..161201)
AA seq 79 aa
MISLLQVRDAVALNGRADAKLLSHQLSASLSMVEAMLEQLTVMGKLEKINATACLSGGCK
QCPEAQKCDTAVYRIAGGH
NT seq 240 nt   +upstreamnt  +downstreamnt
atgattagcctgttacaagtaagggatgccgtcgctctgaatggacgggcagatgctaaa
ttgctgagccaccagctttctgcttcattatcgatggttgaagcgatgcttgaacagctc
accgtaatgggcaaattggaaaagattaatgcaactgcctgcctaagcggcggttgcaaa
caatgtcctgaagcacagaaatgtgatacggcggtttataggattgctggggggcattag

DBGET integrated database retrieval system