Paenibacillus sp. YPG26: LDO05_12390 Help Entry LDO05_12390       CDS       T11186                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism payg  Paenibacillus sp. YPG26 Pathway payg00998   Biosynthesis of various antibiotics payg01100   Metabolic pathways payg01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:payg00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LDO05_12390 (acpP)    00074 Mycolic acid biosynthesis     LDO05_12390 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LDO05_12390 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  USB32133 LinkDB All DBs Position complement(2633799..2634032) Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVVDRLGADEAEVTLEASFKEDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGEVVNYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcattgtagttgatcgcttgggtgctgatgaa gccgaagtaacgcttgaggcttctttcaaagaggaccttggtgctgattcgctcgatgtc gttgaattggttatggaattggaagatgaattcgatcttgaaatttcagatgaagatgca gagaagataacgaccgtaggtgaagttgtaaattacatacaatctcatacctaa

DBGET integrated database retrieval system