Paenibacillus borealis: PBOR_05940 Help Entry PBOR_05940        CDS       T03324                                  Name (GenBank) translocase   KO K03116   sec-independent protein translocase protein TatA Organism pbd  Paenibacillus borealis Pathway pbd03060   Protein export pbd03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:pbd00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     PBOR_05940  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     PBOR_05940  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:pbd02044]     PBOR_05940 Secretion system [BR:pbd02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    PBOR_05940 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  TatA_B_E DUF765 Motif Other DBs NCBI-ProteinID:  AIQ56530 UniProt:  A0A089L8W1 LinkDB All DBs Position 1350389..1350631 Genome browser AA seq 80 aa AA seqDB search MLNGIGAPGIILLVILALLLFGPNKLPELGRAVGRTFREFKDGAREIINEPEPARKSEVP ASPAPQTVAAELPQDRRLPE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgctaaatggtattggtgcacccggaattattctgttggttatcttggcgctcctgctc tttggtccgaataagcttcctgagcttgggcgggcagtcggacgtaccttccgtgaattc aaggacggggcgcgggagattatcaatgaaccggaaccggccagaaagagcgaggtgcct gcttctccggctccgcagactgtagcagcagagcttccgcaggaccgccgtctgccggaa taa

DBGET integrated database retrieval system