Paenibacillus borealis: PBOR_16875 Help Entry PBOR_16875        CDS       T03324                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism pbd  Paenibacillus borealis Pathway pbd00998   Biosynthesis of various antibiotics pbd01100   Metabolic pathways pbd01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pbd00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PBOR_16875    00074 Mycolic acid biosynthesis     PBOR_16875   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PBOR_16875 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Motif Other DBs NCBI-ProteinID:  AIQ58420 UniProt:  A0A089LED4 LinkDB All DBs Position 3852459..3852692 Genome browser AA seq 77 aa AA seqDB search MSDVLERVKRIVIDRLGADEAEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDEDA ESITTVGEVVKYIQSHT NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgatgtattggagcgtgtaaaacgcattgtcatcgaccgcttaggtgccgatgaa gctgaggtaacattagaagcgtctttcaaagatgatttaggtgctgattctcttgatgta gtagaattggttatggaattggaagatgaattcgatatggaaatctctgatgaagatgca gagagtattacgaccgtgggtgaagttgtgaagtacatacaatctcatacctag

DBGET integrated database retrieval system