Paraclostridium bifermentans: KXZ80_15155 Help Entry KXZ80_15155       CDS       T07479                                  Name (GenBank) 4Fe-4S binding protein   KO K00176   2-oxoglutarate ferredoxin oxidoreductase subunit delta [EC:1.2.7.3] Organism pbif  Paraclostridium bifermentans Pathway pbif00020   Citrate cycle (TCA cycle) pbif00720   Other carbon fixation pathways pbif01100   Metabolic pathways pbif01110   Biosynthesis of secondary metabolites pbif01120   Microbial metabolism in diverse environments pbif01200   Carbon metabolism pbif01210   2-Oxocarboxylic acid metabolism Brite KEGG Orthology (KO) [BR:pbif00001]  09100 Metabolism   09101 Carbohydrate metabolism    00020 Citrate cycle (TCA cycle)     KXZ80_15155   09102 Energy metabolism    00720 Other carbon fixation pathways     KXZ80_15155 Enzymes [BR:pbif01000]  1. Oxidoreductases   1.2  Acting on the aldehyde or oxo group of donors    1.2.7  With an iron-sulfur protein as acceptor     1.2.7.3  2-oxoglutarate synthase      KXZ80_15155 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Fer4 Fer4_6 Fer4_7 Fer4_10 Fer4_2 Fer4_21 Fer4_15 Fer4_9 LdpA_Fe-S-bd Fer4_22 Fer4_16 Fer4_4 Fer4_8 Fer4_17 Fer4_13 Fer4_3 Fer4_18 Motif Other DBs NCBI-ProteinID:  UAG18078 LinkDB All DBs Position complement(3154358..3154573) Genome browser AA seq 71 aa AA seqDB search MAKGKVTFDQDLCKGCALCVSACPVKIVEIDKATINKKGYNPASVSDMDKCVGCANCATM CPDAVITVERD NT seq 216 nt NT seq  +upstreamnt  +downstreamnt atggctaagggaaaagttacttttgaccaagacttatgtaaagggtgtgcactttgtgtt tcagcatgtccagttaagattgtagaaatagacaaggctacaataaacaaaaaaggatat aatccagcttctgtttctgatatggacaaatgcgtaggatgtgcaaactgtgcaactatg tgtccagatgcagttataacagtagagagagactaa

DBGET integrated database retrieval system