Desulfobaculum bizertense: LWC08_11035 Help Entry LWC08_11035       CDS       T07819                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism pbiz  Desulfobaculum bizertense Brite KEGG Orthology (KO) [BR:pbiz00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:pbiz03036]     LWC08_11035 (zapB) Chromosome and associated proteins [BR:pbiz03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LWC08_11035 (zapB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB CENP-K YabA bZIP_1 PUMA_CC TSC22 XRCC4_CC Motif Other DBs NCBI-ProteinID:  UIJ37264 LinkDB All DBs Position 2396391..2396621 Genome browser AA seq 76 aa AA seqDB search MDALSQLEARIDSILAKNRVLDEENRRLRQELDLSKKELETKNQTLRDDLERERVAKQDV LTKIDGLLNKLQAEDE NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atggatgcactgagccagctagaagcccgaattgattcaattcttgccaagaatcgggtc cttgatgaagaaaatcgaagacttcggcaagaactcgacctctcaaaaaaagagctcgaa acaaaaaatcaaaccctccgggacgaccttgaacgtgaacgtgtcgcaaaacaagacgtt ctcaccaaaatcgacggtctgctgaacaaacttcaggccgaagacgaatag

DBGET integrated database retrieval system